research papers

IUCrJ
ISSN 2052-2525

BIOLOGY j MEDICINE

Received 4 February 2014
Accepted 24 June 2014

Edited by K. Moffat, University of Chicago, USA
‡ Present address: Translational Genomics
Research Institute, Phoenix, AZ 85004, USA.
§ Present address: European XFEL GmbH,
22761 Hamburg, Germany.
} Present address: Lawrence Livermore
National Laboratory, 7000 East Avenue,
Livermore, CA 94550, USA.
‡‡ Present address: Laboratory of Molecular
Biophysics, Department of Cell and Molecular
Biology, Uppsala University, Husargatan 3
(Box 596), SE-751 24 Uppsala, Sweden.
§§ Present address: Owensboro Cancer
Research Program, Owensboro, KY 42303, USA
and James Graham Brown Cancer Center and
Department of Pharmacology and Toxicology,
University of Louisville School of Medicine,
Louisville, KY 40202, USA.

Keywords: X-ray crystallography; femtosecond
nanocrystallography; HIV-1; gp41; membraneproximal region; cholera toxin B subunit;
crystallization; free-electron lasers
Supporting information: this article has
supporting information at www.iucrj.org

Expression, purification and crystallization of
CTB-MPR, a candidate mucosal vaccine component
against HIV-1
Ho-Hsien Lee,a Irene Cherni,b,c‡ HongQi Yu,a Raimund Fromme,a Jeffrey D.
Doran,b,c Ingo Grotjohann,a Michele Mittman,b,c Shibom Basu,a Arpan Deb,b,c
Katerina Dörner,a Andrew Aquila,d§ Anton Barty,d Sébastien Boutet,e Henry N.
Chapman,d,f R. Bruce Doak,g Mark S. Hunter,a} Daniel James,g Richard A.
Kirian,d,g Christopher Kupitz,a Robert M. Lawrence,a,c Haiguang Liu,g Karol Nass,d,f
Ilme Schlichting,h Kevin E. Schmidt,g M. Marvin Seibert,e‡‡ Robert L. Shoeman,h
John C. H. Spence,g Francesco Stellato,d Uwe Weierstall,g Garth J. Williams,e
Chunhong Yoon,d,i Dingjie Wang,g Nadia A. Zatsepin,g Brenda G. Hogue,b,c
Nobuyuki Matoba,b,c§§ Petra Frommea* and Tsafrir S. Morb,c*
a

Department of Chemistry and Biochemistry, Arizona State University, PO Box 871604, Tempe, AZ 85287-1604, USA,
School of Life Sciences, Arizona State University, PO Box 874501, Tempe, AZ 85287-4501, USA, cCenter for Infectious
Diseases and Vaccinology, Biodesign Institute, Arizona State University, PO Box 874501, Tempe, AZ 85287-5401, USA,
d
Center for Free-Electron Laser Science, DESY, Notkestrasse 85, 22607 Hamburg, Germany, eLinac Coherent Light
Source, SLAC National Accelerator Laboratory, 2575 Sand Hill Road, Menlo Park, CA 94025, USA, fUniversity of
Hamburg, Luruper Chaussee 149, 22761 Hamburg, Germany, gDepartment of Physics, Arizona State University,
PO Box 871504, Tempe, AZ 85287-1504, USA, hMax-Planck-Institut für medizinische Forschung, Jahnstrasse 29,
69120 Heidelberg, Germany, and iEuropean XFEL GmbH, Albert-Einstein-Ring 19, 22761 Hamburg, Germany.
*Correspondence e-mail: petra.fromme@asu.edu, tsafrir.mor@asu.edu
b

CTB-MPR is a fusion protein between the B subunit of cholera toxin (CTB) and
the membrane-proximal region of gp41 (MPR), the transmembrane envelope
protein of Human immunodeficiency virus 1 (HIV-1), and has previously been
shown to induce the production of anti-HIV-1 antibodies with antiviral
functions. To further improve the design of this candidate vaccine, X-ray
crystallography experiments were performed to obtain structural information
about this fusion protein. Several variants of CTB-MPR were designed,
constructed and recombinantly expressed in Escherichia coli. The first variant
contained a flexible GPGP linker between CTB and MPR, and yielded crystals
that diffracted to a resolution of 2.3 Å, but only the CTB region was detected
in the electron-density map. A second variant, in which the CTB was directly
attached to MPR, was shown to destabilize pentamer formation. A third
construct containing a polyalanine linker between CTB and MPR proved to
stabilize the pentameric form of the protein during purification. The purification
procedure was shown to produce a homogeneously pure and monodisperse
sample for crystallization. Initial crystallization experiments led to pseudocrystals which were ordered in only two dimensions and were disordered in
the third dimension. Nanocrystals obtained using the same precipitant showed
promising X-ray diffraction to 5 Å resolution in femtosecond nanocrystallography experiments at the Linac Coherent Light Source at the SLAC National
Accelerator Laboratory. The results demonstrate the utility of femtosecond
X-ray crystallography to enable structural analysis based on nano/microcrystals
of a protein for which no macroscopic crystals ordered in three dimensions have
been observed before.

1. Introduction
The envelope glycoprotein of HIV-1 is a complex composed
of three copies of a heterodimer consisting of gp120 and gp41.
The latter (Fig. 1a) is embedded in the viral membrane,
IUCrJ (2014). 1, 305–317

doi:10.1107/S2052252514014900

305

research papers
mediates the fusion between viral and cellular membranes
(Teixeira et al., 2011) and plays a major role in viral transmission across the epithelial barrier (Shen et al., 2010; Bomsel
et al., 2011; Hessell et al., 2010; Tudor et al., 2009). Mucosal
transmission of HIV-1 through monostratified epithelia
depends on interactions between the viral envelope
membrane protein gp41 and the glycolipid galactosyl ceramide (GalCer) on epithelial cells (Alfsen et al., 2001; Alfsen &
Bomsel, 2002; Meng et al., 2002), and also on dendritic cells,
the most important class of antigen-presenting cells (Bomsel
& Magérus-Chatinet, 2004; Magérus-Chatinet et al., 2007).
The GalCer binding domain of gp41 is mediated by a highly
conserved membrane-proximal region (MPR) of gp41
consisting of residues 649–684. This region of the protein
spans the membrane-proximal external region (MPER; residues 660–683; reviewed by Zwick, 2005), which includes the
epitopes for the broadly neutralizing and transcytosis-blocking
monoclonal human antibodies 2F5, 4E10 and 10E8 (Zwick
et al., 2001; Huang et al., 2012) and, unlike the MPER
itself (residues 650–683), maintains important structural and
functional attributes of the native protein, including oligomerization and GalCer binding (Alfsen & Bomsel, 2002).
An effective vaccine against HIV-1 should ideally consist of
components that target multiple steps of the viral transmission/infection process. Most importantly, it should engage

2. Materials and methods

Figure 1
(a) The architecture of gp41. FP (residues 512–527), fusion peptide; FPPR
(residues 528–539), fusion peptide proximal region; NHR (residues
540–590), N-terminal heptad-repeat region; CHR (residues 628–661),
C-terminal heptad-repeat region; MPER (residues 662–684), membraneproximal external region; MPR (residues 647–684, hatched), membraneproximal region; TM (residues 685–705), transmembrane domain; CTD
(residues 706–856), cytoplasmic C-terminal domain. (b, c, d) DNA
constructs for the expression in E. coli of the indicated CTB-MPR fusion
proteins are based on elements of the pET-22b expression vector. P, T7
bacteriophage promoter; 50 -UTR, upstream untranslated region; pelB,
the periplasmic targeting sequence of pectate lyase B of Erwinia
carotovora; CTB, cholera toxin B subunit; MPR, the membrane-proximal
region of the gp41 protein of HIV-1; 30 -UTR, downstream untranslated
region; T, T7 terminator. The GPGP and AAAA linkers are indicated
above their respective constructs. The three constructs encode the fusion
proteins CTBGPGPMPR (b), CTBMPR (c) and CTBAAAAMPR (d) with
expected molecular masses (after the processing of the pelB leader
sequence) of 16.7, 16.4 and 16.7 kDa, respectively.

306

Ho-Hsien Lee et al.

the virus early in the cycle to minimize the chance of establishing viral reservoirs and subsequent re-dissemination
(Valdiserri et al., 2003). From a worldwide perspective, HIV-1
transmission most commonly occurs through the exposure of
mucosal surfaces to HIV-positive secretions (Pope & Haase,
2003; Hladik & McElrath, 2008; Haase, 2011). Therefore, the
crucial involvement of the MPR in mucosal transmission of
HIV and the well characterized, albeit rare, antiviral immune
responses directed against this domain make it a prime
candidate for an active vaccine.
However, by itself, the MPR was shown to act as a rather
poor immunogen and was sensitive to its structural context
(Denner, 2011). To overcome these limitations and in particular to boost immunogenicity at the mucosal surface, we have
been exploring the MPR through its fusion to the mucosatargeting cholera toxin B subunit (CTB; Matoba et al., 2004,
2006, 2008, 2009). The CTB pentamer is taken up by mucosal
immune cells through endocytosis mediated by binding to GM1
gangliosides (Merritt et al., 1994). Thus, a fusion protein
comprised of CTB and MPR provides the target epitopes
needed to elicit anti-HIV-1 antibodies directed at the MPR
and combines the mucosal targeting of CTB and its immunogenicity. However, anti-MPR responses elicited by CTB-MPR
were not optimal and indicated a need for an improved
MPR-based immunogen (Matoba et al., 2004, 2006, 2008, 2009,
2011).
Understanding the function of MPR and the membraneassociated processes it takes part in, such as transcytosis and
membrane fusion, as well as its interactions with the immune
system, requires knowledge of its structure. To better understand the immunogenicity of the fusion protein and to enable
us to design even more immunogenic MPR fusion proteins, we
turned to structural investigation. Here, we report on the
expression of several novel variants of CTB-MPR with
different linkers between the two fusion partners. We further
report the purification of these proteins and their biochemical
characterization, as well as initial crystallization experiments
and X-ray crystallographic analysis.



CTB-MPR

2.1. Vectors for bacterial expression of CTB-MPR fusion
protein variants

The expression vectors used in this study were all based on
the Escherichia coli periplasmic targeting vector pET-22b()
(Novagen; Figs. 1b, 1c and 1d). The cloning of a synthetic gene
encoding a fusion protein comprising CTB and the MPR with
a flexible GPGP linker between them to obtain the plasmid
pTM101 has been described previously (Matoba et al., 2004).
To obtain a fusion protein without the C-terminal His tag
engineered on the protein product of pTM101, we PCRamplified the coding sequence with primers oTM066 and
oTM123 (see Table 1 for a complete list of the oligonucleotides used in this work), and following digestion with NcoI and
BlpI cloned them into the respective sites in the pET-22b()
IUCrJ (2014). 1, 305–317

research papers
Table 1
Oligonucleotides used as primers in this study.
No. Name
1
2
3
4
5
6

50 -Sequence-30

oTM066
oTM123
oTM468
oTM469

AGCCATGGGCACCCCACAAAACATCACTG
ATTGCTCAGCGGTTCAGATCTTGATATACCAAAGC
GGCAAATTCCCAAACCCAACAAGAGAAGAATG
CTTGTTGGGTTTGGGAATTTGCCATGCTAATGGCAGC
oTM521 GCGGCCGCGGCCTCCCAAACCCAACAAGAG
oTM522 GGCCGCGGCCGCATTTGCCATGCTAATGGC

vector to obtain pTM199. In this work, the fusion-protein
product of this vector is called CTBGPGPMPR.
The plasmid pTM199 served as the template to construct
two additional variants of the fusion protein by overlap PCR
(Aiyar et al., 1996). Briefly, in two separate PCR reactions, the
two ‘end’ primers oTM066 and oTM123 were used, respectively, with two ‘mutagenizing’ primers oTM469 and oTM468
to amplify two partially overlapping fragments of the coding
region of the fusion gene. The two fragments, now containing
the deleted linker region, were gel-purified and used together
as templates with the ‘end’ primers to PCR-amplify the
complete fusion gene. The fragment was cloned into a
pTOPO-TA vector (Invitrogen) to yield pTM545, and the
correct sequence was verified. An NcoI–BlpI fragment from
pTM545 was cloned into the corresponding sites of a
pET-26b(+) vector to yield pTM556. The periplasmic-directed,
linker-less version of the fusion protein encoded by this vector
is referred to here as CTBMPR. A similar strategy (employing
the ‘end’ primers oTM066 and oTM123 together with the
‘mutagenizing’ primers oTM522 and oTM521) was used to
create a vector, pTM646, encoding a variant fusion protein
with a tetra-alanine linker dubbed CTBAAAAMPR.
2.2. Expression and purification of fusion-protein variants

Bacterial expression of CTB-MPR fusion-protein variants
followed our previously published protocol for the
CTBGPGPMPR variant (Matoba et al., 2008). Similarly, we
have modified the previously published purification protocol
(Matoba et al., 2008) to avoid precipitation of the protein at
high pH and to replace the previously used detergents with
detergents that would be compatible with crystallization.
Briefly, cell pellets from 2 l culture (approximately 5 g) were
resuspended in 20 ml ice-cold phosphate-buffered saline
(PBS; 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM
KH2PO4) containing 1 mM phenylmethanesulfonyl fluoride
(PMSF), a serine protease inhibitor, to prevent protein
degradation. The cells were lysed by passing them twice
through a microfluidizer (Microfluidics Microfluidizer) with
PMSF added again after the first pass. The lysate was collected
in a 40 ml Oak Ridge tube and was centrifuged at 36 000g for
20 min. The insoluble fraction was washed once by repeated
resuspension (in 30 ml ice-cold PBS) and centrifugation. If not
immediately used, the pellet was frozen at 80 C.
The pellet, containing the membrane fraction, was resuspended in 30 ml buffer (20 mM bicine pH 8.0, 500 mM NaCl).
To fully homogenize the solution, the sample was sonicated
IUCrJ (2014). 1, 305–317

at 20% amplitude in 30 s runs (Model 300V/T Ultrasonic
Homogenizer, Biologics Inc.) until a homogenous turbid
suspension was obtained. The detergent n-dodecyl--dmaltoside (DDM) was used for solubilization. A stock
solution of 10%(w/v) was added to a final concentration of
1%(w/v). The protein was solubilized at 4 C overnight with
agitation.
The protein solution was centrifuged at 36 000g for 20 min
and the pellet was discarded. A gravity-driven column (BioRad Econo-Column) containing cobalt affinity resin (40 ml
bed volume; Talon, Clontech) was equilibrated with binding
buffer (resuspension buffer supplemented with 0.05%
DDM). The sample was then loaded onto the column and
washed with six bed volumes of binding buffer and ten bed
volumes of wash buffer (20 mM bicine pH 8.0, 50 mM NaCl,
5 mM imidazole, 0.05% DDM) to remove weakly bound
proteins. Tightly bound proteins were eluted by the application of three bed volumes of elution buffer (20 mM bicine pH
8.0, 50 mM NaCl, 150 mM imidazole, 0.05% DDM).
The eluted fractions were pooled and then concentrated
to approximately 2 mg ml1 using 50 kDa molecular-weight
cutoff (MWCO) concentrators (Vivaspin 20 VS2031, Sartorius
Stedim Biotech). Concentrated samples were further purified
by size-exclusion chromatography (SEC; Superdex 200, GE
Healthcare; column volume 24 ml, fluid phase 8 ml) using
a high-pressure liquid-chromatography instrument (HPLC;
ÄKTAexplorer, Pharmacia). The running buffer consisted of
20 mM HEPES pH 7.5, 10 mM CaCl2, 0.02% DDM. For
analytical separations, a sample (200 ml) of concentrated CTBMPR variant was loaded onto the SEC column and chromatography was performed at a flow rate of 0.5 ml min1. The
column was loaded with a maximum of 1 ml sample for
preparative separation runs, with only slight broadening of the
peaks being observed. The protein elution was detected by
absorption at 280 nm. Fractions corresponding to individual
peaks were collected and pooled.
The concentrations of CTB-MPR variant preparations
were determined spectrophotometrically (A280) using "280 =
39 380 M1 cm1 ("280 was calculated with the ProtParam
web application; http://web.expasy.org/protparam/). Assembly
of pentamers of the CTB-MPR variants was monitored by
ELISA using GM1 gangliosides for capture and the MPRspecific human monoclonal antibody 2F5 as described
previously (Matoba et al., 2008) and by nondenaturing SDS–
PAGE (see below).
2.3. SDS–PAGE and immunoblotting

SDS–PAGE using tricine-based buffers in a Bio-Rad MiniPROTEAN Tetra Cell was performed as previously described
by Lawrence et al. (2011) based on the method of Schägger
(2006). Following electrophoresis, the gels were stained with
Coomassie Brilliant Blue, subjected to silver staining (Lawrence et al., 2011) or processed for immunoblotting.
For immunoblotting, the acrylamide gel was rinsed with
water and equilibrated in anode buffer consisting of 60 mM
Tris, 40 mM N-cyclohexyl-3-aminopropanesulfonic acid (CAPS),
Ho-Hsien Lee et al.



CTB-MPR

307

research papers
15% methanol. The PVDF membrane was prepared by
soaking in 100% methanol and then equilibrated in cathode
buffer consisting of 60 mM Tris, 40 mM CAPS, 0.1% SDS. The
gel and the membrane were sandwiched between extra-thick
blot filter papers (Bio-Rad) soaked in the appropriate electrode buffer and proteins were electroblotted for 30 min at
120 mA (Bio-Rad Transfer-blot SD Semi-dry Transfer Cell).
Following blocking for 1 h in PBSTM (PBS, 0.05% Tween 20,
5% dry milk), the PVDF membrane was further incubated in
the presence of the 2F5 monoclonal antibody (kindly provided
by the NIH’s AIDS Reagent Program; 1:10 000 dilution;
Purtscher et al., 1996). The membrane was then washed for 3 
30 min in PBST (PBS, 0.05% Tween 20) prior to incubation
(1 h) with rabbit anti-human IgG conjugated to horseradish
peroxidase (1:20 000 dilution in PBSTM; Santa Cruz
Biotechnology sc-2923). Following three additional 30 min
washes, the PVDF membrane was then soaked with Bio-Rad
Clarity Western ECL substrate solution and imaged with a
UVP BioSpectrum 500C Imaging System.
CTB forms a very stable pentamer that resists dissociation
by SDS in a monomer concentration-dependent manner.
Nonetheless, CTB pentamers can be denatured by heat and
by reduction of the intermolecular disulfide bridges that
stabilize the oligomers (Zrimi et al., 2010; Yasuda et al., 1998).
Nondenaturing SDS–PAGE was conducted as described
above except that DTT was omitted from the loading buffer
and the samples were not boiled prior to loading them onto
gels (Matoba et al., 2008).
2.4. Dynamic light scattering

Dynamic light-scattering (DLS) measurements were
performed using a NaBiTec GmbH setup comprising a
SpectroSize 302 (Molecular Dimensions) in combination with
an S6D microscope (Leica). The purified protein sample
(concentrated to 8 mg ml1 as described above) was illuminated in a 3 ml hanging drop using a 24-well crystallization
plate (VDX Greased Plate, Hampton Research) covered with
siliconized-glass circular cover slides (22 mm; Hampton
Research). The well itself was filled with 600 ml SEC running
buffer. Prior to the measurement, the protein solution was
centrifuged (1000g, 30 min, 4 C) to remove possible dust
particles. During the measurement, the temperature was set to
20 C. Ten consecutive measurements, each with an integration
time of 20 s, were averaged. An estimate of the hydrodynamic
size was obtained with the instrument software using the
following parameters: refractive index 1.33, viscosity 1.006,
shape factor 1.0, hydrated shell 0.2 nm.
2.5. Crystallization experiments

For crystallization experiments, the fusion-protein
preparations were concentrated to a final concentration of
10 mg ml1 using 100 kDa MWCO concentrators (Amicon
Centricon YM-100). Initial broad screening for crystallization
conditions used NeXtal crystallization kits (The PEGs Suite,
The MBClass Suite and The MBClass II Suite) with the vapordiffusion technique. Screening was performed using 96-well

308

Ho-Hsien Lee et al.



CTB-MPR

plates (Qiagen CrystalEX 96-well Conical Flat Plate) with
the sitting-drop method, where each reservoir well contained
100 ml precipitant solution. The purified protein solution was
then mixed in a 1:1 ratio (1 ml:1 ml) with the reservoir solution
in the sitting-drop well.
Conditions that produced crystals served to guide us in fine
screening by the hanging-drop method using 24-well plates
(Hampton Research VDX Greased Plates), with each reservoir well containing 900 ml precipitant solution. The purified
protein solution was then mixed with the reservoir solution
(3 ml each) on a siliconized glass circle cover slide (22 mm;
Hampton Research) and the slide was used to seal the well.
As the broad screening produced crystals in the presence of
polyethylene glycol (PEG), our fine screens centered on the
addition of PEGs of various defined chain lengths (molecular
weights ranging from 300 to 4000) under pH, salt and ionic
strength conditions that produced crystals that were hexagonal from one viewing plane and completely round as viewed
perpendicularly. Specifically, combinatorial screens involved
testing various buffers (50 mM of either sodium acetate pH
4.6, MES pH 6.5 or HEPES pH 7.5) and salts (100 mM of
either NH4Cl, NaCl, CaCl2 or MgCl2).
Fine screens for optimal crystallization conditions of
CTBGPGPMPR were conducted with 0.1 M HEPES pH 7.5
and varying concentrations of PEG 400. The best crystals
appeared using a reservoir solution consisting of 34% PEG
400, 0.2 M BaCl2, 20% ethylene glycol. The hanging drop
contained 1.5 ml reservoir solution, 0.5 ml 2 M ammonium
acetate, 2 ml protein sample and 0.41 ml 10% CYMAL-4
(yielding a final concentration of 0.74% or 2 the critical
micelle concentration).
Fine screens for optimal crystallization conditions of
CTBMPR were conducted with the choice buffer (50 mM
HEPES pH 7.5) and focused on varying concentrations of
choice PEGs (20–40% PEG 300, 5–20% PEG 3000 or 5–20%
PEG 4000) in the presence of 100 mM NH4Cl, NaCl or CaCl2.
In parallel, we conducted salt-concentration screens (50–
200 mM) for NH4Cl, NaCl and CaCl2 in solutions that
contained either 25% PEG 300, 10% PEG 3000 or 10% PEG
4000. Finally, under the choice conditions of buffer, PEG and
salt (50 mM HEPES pH 7.5, 25% PEG 300, 200 mM NH4Cl)
we conducted an additive screen (Hampton Research Additive Screen), in which 96 different additives were added (1 ml)
to the individual drop well in a Qiagen CrystalEX 96-well
Conical Flat Plate along with the protein and reservoir drop
mixture, which consisted of 50 mM HEPES pH 7.5, 20% PEG
300, 10%(w/v) either glycerol, 2-propanol or CYMAL-4 and
200 mM salt (either NH4Cl, NaCl or CaCl2).
Fine screens for optimal CTBAAAAMPR crystallization
conditions were performed with 100 mM Tris pH 8.5 or 50 mM
HEPES pH 7.5 while varying the concentrations of either
PEG 1000 (10–30%) or PEG 3350 (5–20%) in the presence
of 200 mM of either NH4Cl, NaCl, CaCl2 or NH4HCO2. In
parallel, salt-concentration screens of NH4Cl, NaCl, CaCl2 and
NH4HCO2 from 0.05 to 0.2 M were set up with 100 mM Tris
pH 8.5 or 50 mM HEPES pH 7.5 and either 25% PEG 1000 or
10% PEG 3350.
IUCrJ (2014). 1, 305–317

research papers
Table 2

Boutet & Williams (2010) and Boutet et
al. (2012). A suspension of nano/
microcrystals
of
CTBAAAAMPR
Construct
Conditions
1
(9.1 mg ml , total volume of 330 ml)
34% PEG 400, 0.2 M BaCl2, 20% ethylene glycol,
CTBGPGPMPR
was supplied to the FEL X-ray beam
0.5 M ammonium acetate, 0.74% CYMAL-4
25–30% PEG 400, 0.2 M CaCl2, 0.1 M HEPES pH 7.5,
using a gas-focused liquid microjet of
0.3 M galactose, 80–100 mM NaCl
4 mm diameter at 20 C, a temperatureCTBMPR
25–30% PEG 300, 0.2 M CaCl2, 0.05 M HEPES pH 7.5,
controlled antisettling device and a flow
0.02% DDM
25–30% PEG 300, 0.2 M NaCl, 0.05 M HEPES pH 7.5,
rate of 10 ml min1 using a gas dynamic
0.02% DDM
virtual nozzle (Weierstall et al., 2012;
25–30% PEG 300, 0.2 M NH4Cl, 0.05 M HEPES pH 7.5,
DePonte et al., 2008; Weierstall et al.,
0.02% DDM
8–12% PEG 3350, 0.1–0.2 M NH4HCO2, 0.01 M CaCl2,
CTBAAAAMPR
2008; Lomb et al., 2012). X-ray data
0.05 M HEPES pH 7.5, 0.02% DDM
were collected from the crystals at an
AAAA
CTB
MPR nano/microcrystals
30% PEG 3350, 0.2 M NH4HCO2, 0.01 M CaCl2, 0.05 M
energy of 6.3 keV with a 50 fs pulse
HEPES pH 7.5, 0.02% DDM
duration and an X-ray pulse repetition
Nano/microcrystals of CTBAAAAMPR were prepared by
rate of 120 Hz. Diffraction patterns from protein crystals were
identified and selected using the hit-finding program Cheetah
the ultrafiltration method. In this method, the supersaturated
(Barty et al., 2014), and indexing and merging was performed
zone is reached by concentration of the protein by ultrausing CrystFEL (Kirian et al., 2011; White et al., 2012).
filtration while salt, precipitant and buffer concentrations
remain constant. 300 ml purified protein (10 mg ml1) was
mixed with the same volume of precipitant solution consisting
of 200 mM NH4HCO2, 30% PEG 3350, 10 mM CaCl2, 20 mM
3. Results and discussion
HEPES pH 7.5 in a 100 kDa cutoff concentrator (Amicon
3.1. CTBGPGPMPR
Microcon YM-100). The setup was then centrifuged to reduce
the retentate volume by half to regain the original protein
Previous work suggested that the immunogenicity of the
concentration of 10 mg ml1. Following overnight incubation,
MPR depends on its structural context, especially when fused
more precipitant solution was added (30 ml) to further
to other proteins and peptides as is the case for CTB-MPR
increase the yield of nano/microcrystals.
(Gach et al., 2011; Montero et al., 2012; Matoba et al., 2008,
Crystallization conditions are summarized in Table 2.
2011). Three different CTB-MPR fusion variants were
designed that would differ in the linker peptide between the
two fusion partners.
2.6. Standard X-ray crystallography
The original fusion protein that was described previously
GPGP
Characterization of the CTB
MPR crystals was
(Matoba et al., 2004) contained a GPGP linker. It is denoted
performed using synchrotron X-ray radiation on beamline
here as CTBGPGPMPR (Fig. 1b). Two additional variants were
8.2.2 at the Advanced Light Source (ALS) at a wavelength of
created as part of the present study with the GPGP linker
1 Å. The crystals were flash-cooled in liquid nitrogen with a
either deleted (CTBMPR; Fig. 1c) or replaced by a tetra-Ala
cryoprotectant solution (15% ethylene glycol, 50% PEG 400,
linker (CTBAAAAMPR; Fig. 1d). To maximize expression
100 mM HEPES, 60 mM NaCl, 200 mM BaCl2, 150 mM
levels in bacterial cells, all constructs reported here were
imidazole, 0.017% DDM) and diffraction data were collected
devoid of a terminal histidine tag. Instead, we took advantage
at 100 K using an Oxford Cryostream. A total of 520 data
of a peculiarity of the CTB pentamer, preserved in the context

frames were collected using 0.25 oscillations and an exposure
of the fusion proteins, that allows it to specifically bind to
time of 2.275 s per frame with an ADSC 315 detector.
metal-affinity resin (Dertzbaugh & Cox, 1998). Importantly, in
the absence of a His tag only assembled pentamers can bind
2.7. Serial femtosecond nano/microcrystallography
to the metal column (Dertzbaugh & Cox, 1998). The fusion
proteins were expressed as described by Matoba et al. (2008)
Nano/microcrystals were grown on-site and were analyzed
and were purified as described in x2 using the mild detergent
by DLS prior to serial femtosecond X-ray nano/microDDM for solubilization and in all further purification steps to
crystallography using the high-energy free-electron laser at
facilitate crystallization efforts and biophysical analyses.
the Coherent X-ray Imaging (CXI) endstation of the Linac
The purification scheme described above for CTBGPGPMPR
Coherent Light Source (LCLS) at SLAC National Accelerator
Laboratory (Experiment L432, February 2012). This method
fusion proteins resulted in >99% purity based on silver-stained
allows data to be collected from hundreds of thousands of subpolyacrylamide gels (Matoba et al., 2008). As previously
micrometre nano/microcrystals (by spraying them across a
demonstrated by nondenaturing gel electrophoresis and by
pulsed X-ray laser beam) using X-ray snapshots so brief that
GM1 ganglioside ELISA (Matoba et al., 2004, 2008), such
they outrun radiation damage (for a review of the method,
protein preparations were highly homogeneous, consisting of
see Spence et al., 2012). Data were collected from a stream of
primarily pentameric CTBGPGPMPR and only minor amounts
fully hydrated nano/microcrystals. Experimental details of the
of higher molecular-weight aggregates and monomeric
beamline and data collection at CXI have been described by
protein. We were able to separate these various molecular
Crystallization conditions.

IUCrJ (2014). 1, 305–317

Ho-Hsien Lee et al.



CTB-MPR

309

research papers
forms by SEC–HPLC (Fig. 2a). Oligomeric state assignment
of the peaks was performed based on parallel SEC–HPLC
runs with molecular-weight standards. This assignment was
confirmed by resolving proteins in the pooled fractions
corresponding to the peaks by SDS–PAGE under nonreducing
conditions, which allows CTB to retain its pentameric organization (Fig. 2b; Yasuda et al., 1998; Zrimi et al., 2010). Taken
together with the fact that that CTBGPGPMPR binds to the
affinity resin, we conclude that the fusion protein is a stable
pentamer.
Taking advantage of the presence of five tryptophan residues within the MPR domain (with one more within the CTB
moiety), we subjected the proteins in the pooled fractions
corresponding to CTBGPGPMPR pentamers to fluorescence
spectroscopy (Fig. 2a, inset). The emission spectrum revealed
that the Trp residues in the pentamers were exposed to the
aqueous milieu (peak emission at 347 nm; Ni et al., 2011;
Reshetnyak et al., 2001). The stability of the pentamers was
demonstrated by the conservation of the Trp emission profile
upon purification and concentration of the protein.
We screened a large number of crystallization conditions
which included systematic variation of the protein concentration, pH, precipitant and ionic strength. Furthermore, we
tested the reversibility of the crystallization conditions. The
initial screens provided important information on the solubility of CTBGPGPMPR. The addition of galactose is essential for
crystallization of the protein, while only irreversible precipitation was observed in its absence. Reversible precipitation

was observed at pH 7–8 and at medium salt concentrations
(50–250 mM). Crystallization was favored by the addition of

Figure 2
(a) Separation of aggregates and monomers from the pentameric
CTBGPGPMPR protein by gel filtration on a Superdex 200 column.
Assembly status was estimated from parallel resolution of molecularmass standards (not shown). Inset, tryptophan fluorescence emission
spectra of pentameric CTBGPGPMPR in pooled gel-filtration fractions
corresponding to the major peak in (a). 1 (green), pentamers; 2 (blue),
concentrated (Centricon 100) pentamers. Excitation was at 280 nm. (b)
Proteins in the unconcentrated metal-affinity chromatography (MAC)
eluate and in the size-exclusion chromatography (SEC) fraction
corresponding to the main peak of the chromatogram in (a) were
resolved by SDS–PAGE under nondenaturing (ND; no DTT and no
boiling) and denaturing (D) conditions. Molecular-weight standards
indicate that CTBAAAAMPR is organized into SDS-stable pentamers. The
compact pentamers have a slightly higher electrophoretic mobility than
expected based on their mass alone.

310

Ho-Hsien Lee et al.



CTB-MPR

Figure 3
The CTBGPGPMPR structure reveals the expected pentameric ring
arrangement typical of wild-type CTB but not the structure of the MPR.
Cartoon representation of the crystal structure of CTBGPGPMPR in two
orientations: (a) top view, (b) side view. Each subunit is indicated by a
different color. The C-terminus of one of the subunits is indicated in red.
This region is shown in close-up in (c). (c) 2Fo  Fc electron-density map
at a contour level of 1.5 of the C-terminus of CTB in CTBGPGPMPR,
which was phased with the pentameric CTB model (PDB entry 1jr0;
Pickens et al., 2002) using molecular replacement (McCoy et al., 2007).
Electron density can be seen beyond the terminal asparagine of CTB
where the GPGP linker and MPR connect.
IUCrJ (2014). 1, 305–317

research papers
divalent cations (e.g. Ca2+) over monovalent cations, and
shorter-chain polyethylene glycol polymers (PEGs) were the
preferred precipitants.
We found multiple conditions where crystals formed
(Supplementary Fig. S1). The crystals were grown in 0.1 M
HEPES pH 7.5, 25–30% PEG 400, 0.2 M CaCl2, 0.3 M
galactose, 80–100 mM NaCl at a protein concentration of
5 mg ml1. The vapor-diffusion method (sitting drop) using
‘screw-cap’ plates (NeXtal) was used. Isolated crystals were
cooled in liquid nitrogen in crystallization buffer containing
36% PEG 400 as a cryoprotectant. X-ray data were collected
on beamline 8.3.1 at the Advanced Light Source (ALS). Most
of the 50 mm crystals diffracted to about 20 Å resolution. The

Table 3
Crystallographic data for CTBGPGPMPR.
Values in parentheses are for the highest resolution bin.
Wavelength (Å)
Resolution range (Å)
Space group
Unit-cell parameters (Å,  )
Total reflections
Unique reflections
Multiplicity
Completeness (%)
Mean I/(I)
Wilson B factor (Å2)
Rmerge
R factor
Rfree
No. of atoms
No. of macromolecules
No. of waters
No. of protein residues
R.m.s.d., bonds (Å)
R.m.s.d., angles ( )
Ramachandran favored (%)
Ramachandran allowed (%)
Ramachandran outliers (%)
Clashscore
B factors (Å2)
Average
Macromolecules
Solvent

1.0
59.48–2.10 (2.21–2.10)
R3:H
a = b = 174.39, c = 64.71,
 =  = 90,  = 120
162139
42785
3.8 (3.8)
99.95 (100.00)
6.68 (1.93)
30.72
0.136 (1.302)
0.214 (0.315)
0.249 (0.388)
4365
4100
265
515
0.008
1.08
98
1.8
0.2
8.52
40
39.9
42.6

reflections were broad and anisotropic, indicative of the low
order of the crystals in three dimensions. One unit-cell parameter was identified to be 45 Å.
Under slightly different crystallization conditions that
included the presence of Zn2+ and lipids, crystals were
observed that diffracted to a resolution limit of 2.3 Å. A full
data set was collected from these crystals at the Advanced
Photon Source (Table 3). Unfortunately, only the CTB region
was ordered in the electron-density map, definitively demonstrating its pentameric nature (Figs. 3a and 3b). Weak electron
density was observed that extended the C-terminus of CTB,
but the structure of the MPR region could not be resolved in
the crystals (Fig. 3c). We hypothesized that this may be caused
by the flexibility of the GPGP linker allowing the MPR region
to assume multiple positions in the crystals.

3.2. CTBMPR
Figure 4
Affinity chromatography purification of CTBMPR. Protein samples from
various steps in the purification process were resolved next to molecularweight markers (lane 1) by SDS–PAGE and the gel was stained with
Coomassie Brilliant Blue (upper panel). The whole cell lysate (lane 2)
was spun down and the aqueous fraction (lane 3) was discarded.
Membrane proteins were extracted from the pellet with DDM (lane 4)
purified over an affinity chromatography column. The flowthrough was
collected (lane 5) and the column was extensively washed as described in
the text (lane 6, first wash fraction; lane 7, last wash fraction). Elution
required a larger volume of imidazole elution buffer to elute most of the
protein bound to the column (lanes 8–10) than expected based on
previous results with CTBGPGPMPR (Matoba et al., 2008). Immunoblotting was performed on the same samples using monoclonal 2F5
antibodies (lower panel).
IUCrJ (2014). 1, 305–317

To test our hypothesis regarding linker flexibility, we
created a second fusion protein variant in which the movement of the MPR domain was expected to be restricted by
direct fusion of the MPR to the C-terminus of the CTB protein
(CTBMPR; Fig. 1c).
The purification procedure for the linker-less fusion protein
CTBMPR followed the same scheme as outlined above except
that elution was conducted batchwise with extended incubation periods (from 10 min to 16 h) and higher concentrations
of imidazole (300 mM) were required to elute most of the
protein from the column (Fig. 4). The molecular mass of the
fusion protein as estimated based on SDS–PAGE resolution
Ho-Hsien Lee et al.



CTB-MPR

311

research papers
(Fig. 4a) and immunoblotting (Fig. 4b) fitted the calculated
value based on the sequence of the protein (17 kDa).
The homogeneity of the fusion protein in the pooled eluted
fractions was tested by SEC–HPLC. This demonstrated that
the preparation can be resolved into various peaks (Fig. 5).
The results showed that unlike CTBGPGPMPR, the linker-less
fusion protein exists in an equilibrium between several
oligomeric molecular forms. Assignment of the oligomeric
forms is based on the similarity in the elution volumes of the
respective peaks to those of CTBGPGPMPR. Pentamers are
not the predominant form of the linker-less CTBMPR protein,
at least under our purification conditions. A substantial
monomeric population is present alongside the pentamers in
preparations obtained under similar purification conditions to
those used in the purification of CTBGPGPMPR. In fact, since
all of the protein loaded onto the SEC–HPLC column was
specifically eluted from the metal-affinity column (and
consequently must have been pentameric), it is likely that the
CTBMPR pentamer undergoes (partial) disassembly during
manipulation following the metal-affinity chromatography
stage.
While gp41 is generally assumed to form trimers (Liu et al.,
2008; Atilgan et al., 2010) in its pre-fusion form, the involvement of the MPR domain in trimerization is less clear and
evidence for alternative associations exist (see, for example,
Alfsen & Bomsel, 2002). This suggests that the equilibrium
between the various oligomeric states is dynamic and may be
explained by the competing tendencies of the CTB fusion
partner to form pentamers, while the MPR fusion partner may
push the equilibrium against pentamerization.
To investigate this hypothesis, we separately pooled the
fractions corresponding to the monomeric and the pentameric
forms of CTBMPR, concentrated them and analyzed them
separately by SEC–HPLC (Fig. 6). The pentamer appeared to
be stable, leading to a single peak with the same elution time.

However, upon concentration of the monomer-containing
fractions, most of the fusion protein was shown to elute as a
fraction corresponding to the pentamer fraction, suggesting a
reorganization of the protein into pentamers. These results
provided support for our hypothesis that a dynamic
concentration-dependent equilibrium exists between the
various oligomeric forms of CTBMPR, where lower concentrations favor monomers and higher concentrations favor
pentamer formation.
We carried out crystallization experiments of CTBMPR
using the vapor-diffusion method and broad crystal screening,
as described earlier, to identify conditions where crystals were
able to form. Disappointingly, only a few conditions led to
ordered precipitate or pseudo-crystals, and finer screens
around the conditions did not produce three-dimensionally

Figure 5
CTBMPR exists in several metastable oligomeric forms. Affinity-purified
CTBMPR was resolved by SEC–HPLC, yielding three major peaks
probably corresponding to pentamers (fraction 8) and monomers
(fraction 16). Fractions 21 and 23 did not contain appreciable amounts
of protein and are likely to contain high concentrations of imidazole. The
shoulder at the right of the pentamer peak (fraction 11) may represent
the less stable intermediates tetramers and dimers. These fractions
(numbered in red), alongside the original sample and a precipitate that
formed in the original sample, were analyzed by SDS–PAGE followed by
silver staining (inset).

312

Ho-Hsien Lee et al.



CTB-MPR

Figure 6
The CTBMPR oligomeric state is affected by the concentration of the
protein. SEC–HPLC fractions corresponding to the pentamer (a) and
monomer (b) peaks (Fig. 5) were subjected separately to a second SEC–
HPLC purification. Absorbance is normalized to the highest peak.
IUCrJ (2014). 1, 305–317

research papers
ordered crystals. A possible explanation is that the instability
of the oligomeric states hinders the formation of crystals.
3.3. CTBAAAAMPR

Based on the results with CTBMPR, we designed a third
variant of the CTB-MPR fusion protein, CTBAAAAMPR
(Fig. 1d), that links the two fusion partners with a short
polyalanine peptide that is expected to assume an -helical
conformation (O’Neil & DeGrado, 1990). Our aim was to
allow the fusion protein to assemble into stable pentamers by
facilitating the ability of the MPR moieties to interact with
each other while avoiding presumed disorder induced by the
flexible GPGP linker. The SEC–HPLC purification profile
resembled that for the CTBGPGPMPR variant (Fig. 7a). The
formation of the pentamer, as verified by nondenaturing
SDS–PAGE, was still concentration-dependent; however, the
pentamer was much more stable for CTBAAAAMPR than for
the linker-less construct CTBMPR (Fig. 7b).
We obtained the size distribution of the purified
CTBAAAAMPR by dynamic light scattering (DLS) to determine whether the protein preparation was monodisperse
(Fig. 8). At 8 mg ml1, the hydrodynamic radius (Stokes
radius, r) of the detergent-solubilized protein (i.e. of the
protein–detergent micelles) was determined to be 6.2 
0.4 nm. The polydispersity was estimated to be 6%, which is
well below the 10–15% level considered as monodisperse
(Proteau et al., 2010). Note that the DLS measurement in
Fig. 8 shows the direct scattering intensity, which is not
corrected for the molecular mass of the particles to detect
even traces of aggregates. As the increase in scattered intensity is proportional to r6, we calculated that the sample was
highly monodisperse and contained less than 0.00001%

aggregates. Since the exact geometry of CTBAAAAMPR is not
known, a generic set of parameters was used assuming that the
folded state is spherical with an estimated molecular mass of
210 kDa, which includes the detergent bound to the protein.
The DLS data indicated that CTBAAAAMPR may form a
dimer of pentamers, corresponding to a molecular weight of
170 kDa for the protein, while a trimer of pentamers would be
250 kDa larger than the value calculated based on the DLS
results. However, it is difficult to determine how much of the

Figure 8
Figure 7
CTBAAAAMPR resolved as an oligomer by SEC–HPLC. Pink line, the
Talon column eluate (not concentrated). Blue line, 10 concentrated
eluate sample. Red line, 20 concentrated eluate sample. Spectrograms
were normalized to the highest peak. Inset: proteins in fractions
corresponding to the main peak of the 20 concentrated eluate
chromatogram were resolved by SDS–PAGE under nondenaturing
(ND; no DTT and no boiling) and denaturing (D) conditions.
Molecular-weight standards indicate that CTBAAAAMPR is organized
into SDS-stable pentamers.
IUCrJ (2014). 1, 305–317

CTBAAAAMPR is monodisperse as a high-order oligomer. (a) DLS
measurements were performed so that the size distribution in the sample
was analyzed for 20 s and the measurement was repeated consecutively
ten times. The moment-to-moment fraction of particles estimated to have
a particular hydrodynamic radius is color-coded and shown as a heat plot
(red, >90%; blue, none). The narrow vertical and red profile shown
indicates high stability over the duration of the measurement and low
polydispersity. Time: the total duration of the scanning session (200 s). (b)
A distribution curve of particle-size frequencies gives a more quantitative
evaluation of the polydispersity, with the mean  SD indicated next to the
peak. The standard deviation of the size distribution is only 6% of the
mean, indicating low polydispersity.
Ho-Hsien Lee et al.



CTB-MPR

313

research papers
despite the fact that CTBAAAAMPR appeared to be more
stable and more homogeneous than CTBMPR, the crystal
quality was still poor. Under most conditions, pseudo-crystals
were observed and were similar in shape to the CTBGPGPMPR
crystals (Fig. 9). The crystals shown in Fig. 9(a) feature a
hexagonal shape when viewed from the ‘top’, but are
completely round when viewed from the
side. X-ray diffraction patterns from
these crystals show features of a hexagonal powder diffraction pattern, which
may indicate that the crystals consist
of stacks of two-dimensional crystals
which are disordered in the third
dimension. However, we noticed that
crystal disorder seemed to be correlated
with the size of the crystals, with larger
crystals displaying more disorder.
Taking this into account, crystals
were rapidly grown by a fast increase of
the supersaturation state using ultrafiltration to concentrate the protein
at a constant precipitant concentration
(Fig. 10). Most of the crystals were
smaller than the shortest wavelength of
visible light; they had the appearance of
amorphous precipitates, with very small
microcrystals also visible in the sample
(Fig. 10), and this mixture of small (1–
2 mm) and very small (<1 mm) crystals
will be referred to here as ‘nano/
microcrystals’. CTBAAAAMPR nano/
microcrystals were grown on site at
Figure 9
LCLS, characterized by DLS and
AAAA
CTB
MPR crystals form under different conditions of a fine screen. (a) 0.2 M ammonium
SONICC and their diffraction quality
formate, 8% PEG 3350. (b) 0.2 M ammonium formate, 5% PEG 3350. (c) 0.2 M ammonium
was tested by the new method of serial
formate, 12% PEG 3350. (d) 0.1 M ammonium formate, 10% PEG 3350
estimated molecular mass was associated with the detergent
micelles around the hydrophobic regions of the protein.
A large set of crystallization experiments was carried out
with purified CTBAAAAMPR similarly to that described above
for the linker-less variant CTBMPR. Crystals were observed
more frequently for CTBAAAAMPR than for CTBMPR, but

Figure 10
Nano/microcrystals of CTBAAAAMPR grown in 0.2 M ammonium formate, 30% PEG 3350 before (a) and after (b) filtering through a 20 mm filter. The
cystals in (b) are shown at a higher magnification.

314

Ho-Hsien Lee et al.



CTB-MPR

IUCrJ (2014). 1, 305–317

research papers
(109 higher peak brilliance than the brightest third-generation
synchrotrons). The 10–50 fs pulses are so brief that the
Run time
10 min 40 s
diffraction of each nano/microcrystal is recorded before it is
Total No. of raw frames
72767
disintegrated. This diffract-before-destroy principle (Barty et
No. of crystal hits
1006
al., 2012) overcomes the X-ray damage problem in convenHit rate (%)
1.38
No. of indexed patterns
55
tional crystallography and allows data collection from crystals
Indexing yield (%)
5.46
that contain only a few hundred molecules (Chapman et al.,
Unit-cell parameters (Å,  )
a = b = c = 332,  =  =  = 60
2011). The results from the LCLS beamtime were very
Space group
R32
promising, as we were able to grow crystals on site and
detected the first single-crystal diffraction patterns from
CTBAAAAMPR nano/microcrystals. While the larger crystals
femtosecond crystallography (SFX) on the CXI beamline at
the LCLS. This beamtime was dedicated to the exploration of
of CTBAAAAMPR were disordered in the third dimension, the
nano/microcrystals are ordered in all three dimensions and
the use of SFX for structure elucidation of membrane proteins
show a low degree of disorder. We did not observe any
following the seminal work by Chapman et al. (2011) and
anisotropy of the diffraction patterns even in the third
Boutet et al. (2012). These articles provide detailed description
dimension. This is particularly striking since the nano/microof sample delivery and data collection that will only briefly be
crystals of the protein were grown using the same set of
recounted here (see the review by Spence et al., 2012). Millions
precipitants at initial higher concentration, therefore reaching
of X-ray data diffraction snapshots were collected from a
the supersaturation and nucleation phase much faster than
stream of protein nanocrystals or microcrystals in their mother
in the vapor-diffusion experiment leading to the larger disliquor at room temperature as they flow across the beam.
ordered crystals. A single sort short run of the CTBAAAAMPR
Diffraction snapshots of individual crystals of CTBAAAAMPR
were collected using X-rays pulses of extremely high intensity
nano/microcrystals allowed us to collect 1006 patterns, most of
which showed diffraction to 4–6 Å
resolution and were successfully
indexed (see two typical diffraction
patterns and their indexed images in
Fig. 11; Table 4). From the indexed
patterns, we were able to determine the
space group and the unit-cell parameters. The crystals appear to be
rhombohedral (consistent with point
group R32 with unit-cell parameters a =
b = c = 332 Å,  =  =  = 60 ). There
are only a few published examples of
structures with space group R3 and a
similar unit-cell parameter to that we
observed here for the CTBAAAAMPR
fusion protein. Interestingly, the three
examples we could find in the PDB
happen to be of viral origin. These PDB
entries include the structure of Physalis
mottle virus (PDB entry 1qjz; Krishna et
al., 1999), with unit-cell parameters a =
b = c = 294 Å,  =  =  = 59.91 , and the
structures of the Sesbania mosaic virus
coat protein (PDB entry 1smv; Bhuvaneshwari et al., 1995) and its mutant
(PDB entry 1x33; Sangita et al., 2005),
with unit-cell parameters a = b =
c = 291 Å,  =  =  = 62 .
Since each diffraction pattern is a
‘still image’ and most reflections are
partial, accurate determination of
structure requires high redundancy of
Figure 11
the data set, i.e. many recordings in the
AAAA
(a) Two CTB
MPR diffraction patterns collected from nano/microcrystals on the CXI
vicinity
of each reflection, in order to
beamline at LCLS in February 2012. (b) Indexing of the diffraction patterns in (a). The yellow
provide angular integration across the
circles indicate the predicted positions of the reflections.
Table 4

Crystallographic data for CTBAAAAMPR.

IUCrJ (2014). 1, 305–317

Ho-Hsien Lee et al.



CTB-MPR

315

research papers
Bragg condition. For example, the first near-atomic resolution
structure of a protein to be determined using femtosecond
crystallography contained more than 12 000 indexed diffraction patterns (Boutet et al., 2012). While the minimum number
of single crystal hits that are required for structure analysis is
currently unknown, the thousand reflections that we were able
to collect with our very small sample size did not constitute a
full native data set that could support structure determination;
more data will have to be collected to this end.
It was surprising to see that the nano/microcrystals of
CTBAAAAMPR (most of which are <1 mm) are ordered in
three dimensions while the larger (100–300 mm) crystals grown
with the same set of precipitants are completely disordered
in the third dimension. We are currently screening conditions
and applying seeding techniques to grow crystals of defined
micrometre sizes from the nano/microcrystals for conventional X-ray data collection at synchrotron microfocus
beamlines. The plan is to test the diffraction quality of crystals
with target sizes ranging from 5 to 100 mm to determine up to
which size the crystals are still ordered in three dimensions,
with the goal of identifying a ‘single-crystal threshold’ that
may enable data collection at microfocus beamlines. We can
then further optimize the crystal quality of the microcrystals
by fine screening of the conditions, including the screening of
additives.
NMR and crystal structures have been determined of small
peptide derivatives of the MPR region that contain binding
sites for neutralizing antibodies (Biron et al., 2005; Song et al.,
2009; Pejchal et al., 2009) and the consensus is that this peptide
can assume an -helical conformation. Further structural
information on the MPR region was obtained by studies
involving an in vitro-assembled six-helix bundle consisting of
separately produced peptide derivatives of gp41 (Shi et al.,
2010) and a chimeric protein consisting of a series of gp41
peptides separated by linkers (Buzon et al., 2010). The
conformations observed in these studies are very likely to
represent the post-fusion form of MPR. However, the structure shows that the 2F5 binding site is deeply buried inside the
three-helix bundle (Shi et al., 2010; Buzon et al., 2010) and
therefore these constructs may not induce 2F5-like neutralizing antibodies. During the fusion process, large conformational changes must occur in gp41 that break the interaction
between the trimers and expose the 2F5 antibody-binding site,
thereby allowing 2F5 to block fusion and transcytosis; thus, a
structure of the fusion-active form of MPR is highly desired.
Our ultimate goal is to design an optimal CTB-MPR construct
that can serve as a vaccine against HIV. Our design of the
MPR fusion with CTB is based on the idea of a symmetry
mismatch, where the pentameric oligomeric state of CTB
hinders the formation of trimers of MPR and thereby stabilizes the MPR region of gp41 in its pre-fusion active form.
While we present major strides in this work, further
improvement of both the traditional X-ray crystallography
approach (including co-crystallization with neutralizing antibodies) and less-explored innovations such as serial femtosecond crystallography are needed to allow us to meet this
goal.

316

Ho-Hsien Lee et al.



CTB-MPR

This work presents a proof of principle that threedimensionally ordered nano/microcrystals can be grown from
a protein that had so far resisted growth of any macroscopic
crystals that were ordered in three dimensions. Most
remarkable is the fact that the SFX diffraction patterns clearly
indicate that the nano/macrocrystals were single crystals,
while macroscopic crystals grown with the same chemical
compounds as precipitants showed the features of twodimensional crystals stacked nearly randomly in the third
dimension. Further enhancement of the quality of the nano/
microcrystals by application of improved methods of nanocrystal growth (Kupitz et al., 2014) and the collection of a full
data set from these crystals by serial femtosecond nanocrystallography would allow us to determine the structure of
CTBAAAAMPR.

Acknowledgements
We would like to thank Eric Davies (Arizona State University) for technical assistance with the cloning. This work was
supported in part by the National Institutes of Health (awards
U19 AI062150 to TM; U54 GM094599 to PF, BH and TM;
1R01GM095583 to PF; and R03 AI073157 to NM). We also
gratefully acknowledge support by the US National Science
Foundation (NSF; award MCB 1120997). Conventional and
serial femtosecond crystallography experiments were carried
out at the Advanced Light Source (ALS) and the Linac
Coherent Light Source (LCLS), respectively, which are
national user facilities operated by the University of California and Stanford University, respectively, on behalf of the
US Department of Energy (DOE), Office of Basic Energy
Sciences. We are grateful for an NSF award (MCB-1021557)
to JCHS. We acknowledge support from DOE through the
PULSE Institute at the SLAC National Accelerator Laboratory and by Lawrence Livermore National Laboratory under
Contract DE-AC52-07NA27344. HL’s work was partially
supported by Human Frontiers Science Project award No.
024940. We also acknowledge the support of the Helmholtz
Association and the Max Planck Society.

References
Aiyar, A., Xiang, Y. & Leis, J. (1996). Methods Mol. Biol. 57, 177–191.
Alfsen, A. & Bomsel, M. (2002). J. Biol. Chem. 277, 25649–25659.
Alfsen, A., Iniguez, P., Bouguyon, E. & Bomsel, M. (2001). J.
Immunol. 166, 6257–6265.
Atilgan, C., Gerek, Z. N., Ozkan, S. B. & Atilgan, A. R. (2010).
Biophys. J. 99, 933–943.
Barty, A. et al. (2012). Nature Photonics 6, 35–40.
Barty, A., Kirian, R. A., Maia, F. R. N. C., Hantke, M., Yoon, C. H.,
White, T. A. & Chapman, H. (2014). J. Appl. Cryst. 47, 1118–1131.
Bhuvaneshwari, M., Subramanya, H. S., Gopinath, K., Savithri, H. S.,
Nayudu, M. V. & Murthy, M. R. (1995). Structure, 3, 1021–1030.
Biron, Z., Khare, S., Quadt, S. R., Hayek, Y., Naider, F. & Anglister, J.
(2005). Biochemistry, 44, 13602–13611.
Bomsel, M. & Magérus-Chatinet, A. (2004). Mol. Biol. Cell, 15, 440A.
Bomsel, M. et al. (2011). Immunity, 34, 269–280.
Boutet, S. & Williams, G. J. (2010). New J. Phys. 12, 035024.
Boutet, S. et al. (2012). Science, 337, 362–364.
Buzon, V., Natrajan, G., Schibli, D., Campelo, F., Kozlov, M. M. &
Weissenhorn, W. (2010). PLoS Pathog. 6, e1000880.
Chapman, H. N. et al. (2011). Nature (London), 470, 73–77.
IUCrJ (2014). 1, 305–317

research papers
Denner, J. (2011). Hum. Vaccin. 7, Suppl., 4–9.
DePonte, D. P., Weierstall, U., Schmidt, K., Warner, J., Starodub, D.,
Spence, J. C. H. & Doak, R. B. (2008). J. Phys. D Appl. Phys. 41,
195505.
Dertzbaugh, M. T. & Cox, L. M. (1998). Protein Eng. 11, 577–581.
Gach, J. S., Leaman, D. P. & Zwick, M. B. (2011). Curr. Top. Med.
Chem. 11, 2997–3021.
Haase, A. T. (2011). Annu. Rev. Med. 62, 127–139.
Hessell, A. J., Rakasz, E. G., Tehrani, D. M., Huber, M., Weisgrau,
K. L., Landucci, G., Forthal, D. N., Koff, W. C., Poignard, P.,
Watkins, D. I. & Burton, D. R. (2010). J. Virol. 84, 1302–1313.
Hladik, F. & McElrath, M. J. (2008). Nature Rev. Immunol. 8,
447–457.
Huang, J. et al. (2012). Nature (London), 491, 406–412.
Kirian, R. A., White, T. A., Holton, J. M., Chapman, H. N., Fromme,
P., Barty, A., Lomb, L., Aquila, A., Maia, F. R. N. C., Martin, A. V.,
Fromme, R., Wang, X., Hunter, M. S., Schmidt, K. E. & Spence,
J. C. H. (2011). Acta Cryst. A67, 131–140.
Krishna, S. S., Hiremath, C. N., Munshi, S. K., Prahadeeswaran, D.,
Sastri, M., Savithri, H. S. & Murthy, M. R. (1999). J. Mol. Biol. 289,
919–934.
Kupitz, C., Grotjohann, I., Conrad, C. E., Roy-Chowdhury, S.,
Fromme, R. & Fromme, P. (2014). Philos. Trans. R. Soc. Lond. B
Biol. Sci. 369, doi:10.1098/rstb.2013.0316.
Lawrence, R. M., Varco-Merth, B., Bley, C. J., Chen, J. J.-L. &
Fromme, P. (2011). Protein Expr. Purif. 76, 15–24.
Liu, J., Bartesaghi, A., Borgnia, M. J., Sapiro, G. & Subramaniam, S.
(2008). Nature (London), 455, 109–113.
Lomb, L., Steinbrener, J., Bari, S., Beisel, D., Berndt, D., Kieser, C.,
Lukat, M., Neef, N. & Shoeman, R. L. (2012). J. Appl. Cryst. 45,
674–678.
Magérus-Chatinet, A., Yu, H., Garcia, S., Ducloux, E., Terris, B. &
Bomsel, M. (2007). Virology, 362, 67–74.
Matoba, N., Geyer, B. C., Kilbourne, J., Alfsen, A., Bomsel, M. &
Mor, T. S. (2006). Vaccine, 24, 5047–5055.
Matoba, N., Griffin, T. A., Mittman, M., Doran, J. D., Alfsen, A.,
Montefiori, D. C., Hanson, C. V., Bomsel, M. & Mor, T. S. (2008).
Curr. HIV Res. 6, 218–229.
Matoba, N., Kajiura, H., Cherni, I., Doran, J. D., Bomsel, M.,
Fujiyama, K. & Mor, T. S. (2009). Plant Biotechnol. J. 7, 129–145.
Matoba, N., Magérus, A., Geyer, B. C., Zhang, Y., Muralidharan, M.,
Alfsen, A., Arntzen, C. J., Bomsel, M. & Mor, T. S. (2004). Proc.
Natl Acad. Sci. USA, 101, 13584–13589.
Matoba, N., Shah, N. R. & Mor, T. S. (2011). Vaccine, 29, 5584–
5590.
McCoy, A. J., Grosse-Kunstleve, R. W., Adams, P. D., Winn, M. D.,
Storoni, L. C. & Read, R. J. (2007). J. Appl. Cryst. 40, 658–674.
Meng, G., Wei, X., Wu, X., Sellers, M. T., Decker, J. M., Moldoveanu,
Z., Orenstein, J. M., Graham, M. F., Kappes, J. C., Mestecky, J.,
Shaw, G. M. & Smith, P. D. (2002). Nature Med. 8, 150–156.
Merritt, E. A., Sarfaty, S., van den Akker, F., L’Hoir, C., Martial, J. A.
& Hol, W. G. (1994). Protein Sci. 3, 166–175.
Montero, M., Gulzar, N., Klaric, K. A., Donald, J. E., Lepik, C., Wu,
S., Tsai, S., Julien, J. P., Hessell, A. J., Wang, S., Lu, S., Burton, D. R.,

IUCrJ (2014). 1, 305–317

Pai, E. F., Degrado, W. F. & Scott, J. K. (2012). J. Virol. 86, 2930–
2941.
Ni, D. Q., Zook, J., Klewer, D. A., Nieman, R. A., Soll, J. & Fromme, P.
(2011). Protein Expr. Purif. 80, 157–168.
O’Neil, K. T. & DeGrado, W. F. (1990). Science, 250, 646–651.
Pejchal, R., Gach, J. S., Brunel, F. M., Cardoso, R. M., Stanfield, R. L.,
Dawson, P. E., Burton, D. R., Zwick, M. B. & Wilson, I. A. (2009). J.
Virol. 83, 8451–8462.
Pickens, J. C., Merritt, E. A., Ahn, M., Verlinde, C. L. M. J., Hol,
W. G. J. & Fan, E. (2002). Chem. Biol. 9, 215–224.
Pope, M. & Haase, A. T. (2003). Nature Med. 9, 847–852.
Proteau, A., Shi, R. & Cygler, M. (2010). Curr. Protoc. Protein Sci.,
Unit 17.10.
Purtscher, M., Trkola, A., Grassauer, A., Schulz, P. M., Klima, A.,
Döpper, S., Gruber, G., Buchacher, A., Muster, T. & Katinger, H.
(1996). AIDS, 10, 587–593.
Reshetnyak, Y. K., Koshevnik, Y. & Burstein, E. A. (2001). Biophys.
J. 81, 1735–1758.
Sangita, V., Lokesh, G. L., Satheshkumar, P. S., Saravanan, V., Vijay,
C. S., Savithri, H. S. & Murthy, M. R. N. (2005). Acta Cryst. D61,
1402–1405.
Schägger, H. (2006). Nature Protoc. 1, 16–22.
Shen, R., Drelichman, E. R., Bimczok, D., Ochsenbauer, C., Kappes,
J. C., Cannon, J. A., Tudor, D., Bomsel, M., Smythies, L. E. & Smith,
P. D. (2010). J. Immunol. 184, 3648–3655.
Shi, W., Bohon, J., Han, D. P., Habte, H., Qin, Y., Cho, M. W. &
Chance, M. R. (2010). J. Biol. Chem. 285, 24290–24298.
Song, L., Sun, Z.-Y. J., Coleman, K. E., Zwick, M. B., Gach, J. S.,
Wang, J.-H., Reinherz, E. L., Wagner, G. & Kim, M. (2009). Proc.
Natl Acad. Sci. USA, 106, 9057–9062.
Spence, J. C. H., Weierstall, U. & Chapman, H. N. (2012). Rep. Prog.
Phys. 75, 102601.
Teixeira, C., Gomes, J. R., Gomes, P., Maurel, F. & Barbault, F. (2011).
Eur. J. Med. Chem. 46, 979–992.
Tudor, D., Derrien, M., Diomede, L., Drillet, A. S., Houimel, M.,
Moog, C., Reynes, J. M., Lopalco, L. & Bomsel, M. (2009). Mucosal
Immunol. 2, 412–426.
Valdiserri, R. O., Ogden, L. L. & McCray, E. (2003). Nature Med. 9,
881–886.
Weierstall, U., Doak, R. B., Spence, J. C. H., Starodub, D., Shapiro, D.,
Kennedy, P., Warner, J., Hembree, G. G., Fromme, P. & Chapman,
H. N. (2008). Exp. Fluids, 44, 675–689.
Weierstall, U., Spence, J. C. H. & Doak, R. B. (2012). Rev. Sci.
Instrum. 83, 035108.
White, T. A., Kirian, R. A., Martin, A. V., Aquila, A., Nass, K., Barty,
A. & Chapman, H. N. (2012). J. Appl. Cryst. 45, 335–341.
Yasuda, Y., Matano, K., Asai, T. & Tochikubo, K. (1998). FEMS
Immunol. Med. Microbiol. 20, 311–318.
Zrimi, J., Ng Ling, A., Giri-Rachman Arifin, E., Feverati, G. &
Lesieur, C. (2010). PLoS One, 5, e15347.
Zwick, M. B. (2005). AIDS, 19, 1725–1737.
Zwick, M. B., Labrijn, A. F., Wang, M., Spenlehauer, C., Saphire,
E. O., Binley, J. M., Moore, J. P., Stiegler, G., Katinger, H., Burton,
D. R. & Parren, P. W. (2001). J. Virol. 75, 10892–10905.

Ho-Hsien Lee et al.



CTB-MPR

317